Review



c terminal myc ddk tags  (OriGene)


Bioz Verified Symbol OriGene is a verified supplier
Bioz Manufacturer Symbol OriGene manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 94

    Structured Review

    OriGene c terminal myc ddk tags
    C Terminal Myc Ddk Tags, supplied by OriGene, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/ddk+myc+tags/DDRGK1+(NM_023935)+Human+Tagged+ORF+Clone/pm42277217-175-20-26
    Average 94 stars, based on 1 article reviews
    c terminal myc ddk tags - by Bioz Stars, 2026-09
    94/100 stars

    Images

    Related Articles

    Expressing:

    Article Title: ETV7-Mediated DNAJC15 Repression Leads to Doxorubicin Resistance in Breast Cancer Cells
    Article Snippet: Quercetin and Genistein were purchased from Extrasynthese (Genay, Lyon, France), and treatments were performed for 16 hours at the concentration of 50μM for Quercetin and 30μM for Genistein. .. The expression vectors pCMV6-Entry-Empty, pCMV6-Entry-ETV7 and pCMV6-Entry-DNAJC15 C-terminally tagged with DDK-Myc tags were purchased from Origene (Tema Ricerca, Bologna, Italy). pGL4.26-DNAJC15 reporter was obtained by cloning the promoter region of DNAJC15 (−299 to +512 bp from TSS according to the Eukaryotic Promoter Database, http://epd.vital-it.ch/) amplified with Q5 High Fidelity DNA Polymerase (New England Biolabs, Euroclone, Milan, Italy) and the following primers (Eurofins Genomics): Fw: GCCTCGAGCAGCACAAACTCATTTGAGGG and Rv: GCAAGCTTAGGCGGCCCGGAGACTCAAG. ..

    Article Title: ETV7 regulates breast cancer stem-like cell features by repressing IFN-response genes
    Article Snippet: Radiation treatment was performed using the Elekta Precise Linear Accelerator (Elekta Oncology Systems, Crawley, UK) for different doses and time points. .. The expression vector pCMV6-Entry-ETV7 C-terminally tagged with DDK-Myc tags was purchased from Origene (Tema Ricerca, Bologna, Italy). .. The lentiviral vector pAIP-ETV7 was obtained by cloning using the following primers to amplify the ETV7 gene from pCMV6-Entry-ETV7 and inserting it into the pAIP-Empty plasmid (the tails containing restriction endonucleases’ target sequences are indicated in lowercase): Fw: aggttaacATGCAGGAGGGAGAATTGGCTA Rv: gagaattcTTAAACCTTATCGTCGTCATCC pAIP was a gift from Jeremy Luban (Addgene plasmid #74171; http://n2t.net/addgene:74171 ; Watertown, MA, USA).

    Article Title: ETV7 regulates breast cancer stem-like cell plasticity by repressing IFN-response genes
    Article Snippet: Radiation treatment was performed using the Elekta Precise Linear Accelerator (Elekta Oncology Systems, Crawley, UK) for different doses and time points. .. The expression vector pCMV6-Entry-ETV7 C-terminally tagged with DDK-Myc tags was purchased from Origene (Tema Ricerca, Bologna, Italy). .. The lentiviral vector pAIP-ETV7 was obtained by cloning using the following primers to amplify the ETV7 gene from pCMV6-Entry-ETV7 and inserting it into the pAIP-Empty plasmid (the tails containing restriction endonucleases’ target sequences are indicated in lowercase): Fw: aggttaacATGCAGGAGGGAGAATTGGCTA Rv: gagaattcTTAAACCTTATCGTCGTCATCC pAIP was a gift from Jeremy Luban (Addgene plasmid #74171; http://n2t.net/addgene:74171 ; Watertown, MA, USA).

    Cloning:

    Article Title: ETV7-Mediated DNAJC15 Repression Leads to Doxorubicin Resistance in Breast Cancer Cells
    Article Snippet: Quercetin and Genistein were purchased from Extrasynthese (Genay, Lyon, France), and treatments were performed for 16 hours at the concentration of 50μM for Quercetin and 30μM for Genistein. .. The expression vectors pCMV6-Entry-Empty, pCMV6-Entry-ETV7 and pCMV6-Entry-DNAJC15 C-terminally tagged with DDK-Myc tags were purchased from Origene (Tema Ricerca, Bologna, Italy). pGL4.26-DNAJC15 reporter was obtained by cloning the promoter region of DNAJC15 (−299 to +512 bp from TSS according to the Eukaryotic Promoter Database, http://epd.vital-it.ch/) amplified with Q5 High Fidelity DNA Polymerase (New England Biolabs, Euroclone, Milan, Italy) and the following primers (Eurofins Genomics): Fw: GCCTCGAGCAGCACAAACTCATTTGAGGG and Rv: GCAAGCTTAGGCGGCCCGGAGACTCAAG. ..

    Amplification:

    Article Title: ETV7-Mediated DNAJC15 Repression Leads to Doxorubicin Resistance in Breast Cancer Cells
    Article Snippet: Quercetin and Genistein were purchased from Extrasynthese (Genay, Lyon, France), and treatments were performed for 16 hours at the concentration of 50μM for Quercetin and 30μM for Genistein. .. The expression vectors pCMV6-Entry-Empty, pCMV6-Entry-ETV7 and pCMV6-Entry-DNAJC15 C-terminally tagged with DDK-Myc tags were purchased from Origene (Tema Ricerca, Bologna, Italy). pGL4.26-DNAJC15 reporter was obtained by cloning the promoter region of DNAJC15 (−299 to +512 bp from TSS according to the Eukaryotic Promoter Database, http://epd.vital-it.ch/) amplified with Q5 High Fidelity DNA Polymerase (New England Biolabs, Euroclone, Milan, Italy) and the following primers (Eurofins Genomics): Fw: GCCTCGAGCAGCACAAACTCATTTGAGGG and Rv: GCAAGCTTAGGCGGCCCGGAGACTCAAG. ..

    Plasmid Preparation:

    Article Title: ETV7 regulates breast cancer stem-like cell features by repressing IFN-response genes
    Article Snippet: Radiation treatment was performed using the Elekta Precise Linear Accelerator (Elekta Oncology Systems, Crawley, UK) for different doses and time points. .. The expression vector pCMV6-Entry-ETV7 C-terminally tagged with DDK-Myc tags was purchased from Origene (Tema Ricerca, Bologna, Italy). .. The lentiviral vector pAIP-ETV7 was obtained by cloning using the following primers to amplify the ETV7 gene from pCMV6-Entry-ETV7 and inserting it into the pAIP-Empty plasmid (the tails containing restriction endonucleases’ target sequences are indicated in lowercase): Fw: aggttaacATGCAGGAGGGAGAATTGGCTA Rv: gagaattcTTAAACCTTATCGTCGTCATCC pAIP was a gift from Jeremy Luban (Addgene plasmid #74171; http://n2t.net/addgene:74171 ; Watertown, MA, USA).

    Article Title: ETV7 regulates breast cancer stem-like cell plasticity by repressing IFN-response genes
    Article Snippet: Radiation treatment was performed using the Elekta Precise Linear Accelerator (Elekta Oncology Systems, Crawley, UK) for different doses and time points. .. The expression vector pCMV6-Entry-ETV7 C-terminally tagged with DDK-Myc tags was purchased from Origene (Tema Ricerca, Bologna, Italy). .. The lentiviral vector pAIP-ETV7 was obtained by cloning using the following primers to amplify the ETV7 gene from pCMV6-Entry-ETV7 and inserting it into the pAIP-Empty plasmid (the tails containing restriction endonucleases’ target sequences are indicated in lowercase): Fw: aggttaacATGCAGGAGGGAGAATTGGCTA Rv: gagaattcTTAAACCTTATCGTCGTCATCC pAIP was a gift from Jeremy Luban (Addgene plasmid #74171; http://n2t.net/addgene:74171 ; Watertown, MA, USA).



    Similar Products

    94
    OriGene c terminal myc ddk tags
    C Terminal Myc Ddk Tags, supplied by OriGene, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/ddk+myc+tags/DDRGK1+(NM_023935)+Human+Tagged+ORF+Clone/pm42277217-175-20-26
    Average 94 stars, based on 1 article reviews
    c terminal myc ddk tags - by Bioz Stars, 2026-09
    94/100 stars
      Buy from Supplier

    94
    OriGene plenti c myc ddk p2a puro bend4
    Plenti C Myc Ddk P2a Puro Bend4, supplied by OriGene, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/ddk+myc+tags/BEND4+(NM_207406)+Human+Tagged+ORF+Clone/pm42251161-372-3-4
    Average 94 stars, based on 1 article reviews
    plenti c myc ddk p2a puro bend4 - by Bioz Stars, 2026-09
    94/100 stars
      Buy from Supplier

    94
    OriGene gfpt1 nm 002056 pcmv6 myc ddk plasmid
    Gfpt1 Nm 002056 Pcmv6 Myc Ddk Plasmid, supplied by OriGene, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/ddk+myc+tags/GFPT1+(NM_002056)+Human+Tagged+ORF+Clone/pm42230780-258-0-7
    Average 94 stars, based on 1 article reviews
    gfpt1 nm 002056 pcmv6 myc ddk plasmid - by Bioz Stars, 2026-09
    94/100 stars
      Buy from Supplier

    92
    OriGene pcmv lgr4 myc ddk
    Pcmv Lgr4 Myc Ddk, supplied by OriGene, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/ddk+myc+tags/Lgr4+(NM_172671)+Mouse+Tagged+ORF+Clone/pm42203310-51-5-6
    Average 92 stars, based on 1 article reviews
    pcmv lgr4 myc ddk - by Bioz Stars, 2026-09
    92/100 stars
      Buy from Supplier

    94
    OriGene myc ddk tagged klhl11 mouse
    Myc Ddk Tagged Klhl11 Mouse, supplied by OriGene, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/ddk+myc+tags/Klhl11+(NM_172565)+Mouse+Tagged+ORF+Clone/pm42154290-40-6-16
    Average 94 stars, based on 1 article reviews
    myc ddk tagged klhl11 mouse - by Bioz Stars, 2026-09
    94/100 stars
      Buy from Supplier

    94
    OriGene myc ddk trmt61b overexpression plasmid
    Myc Ddk Trmt61b Overexpression Plasmid, supplied by OriGene, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/ddk+myc+tags/Myc+(NM_010849)+Mouse+Tagged+ORF+Clone/pmc13129541-82-0-10
    Average 94 stars, based on 1 article reviews
    myc ddk trmt61b overexpression plasmid - by Bioz Stars, 2026-09
    94/100 stars
      Buy from Supplier

    94
    OriGene murine myc ddk tagged rank tnfrsf11a
    Murine Myc Ddk Tagged Rank Tnfrsf11a, supplied by OriGene, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/ddk+myc+tags/Tnfrsf11a+(NM_009399)+Mouse+Tagged+ORF+Clone/10__1016_slash_j__bonr__2026__101923-98-7-11
    Average 94 stars, based on 1 article reviews
    murine myc ddk tagged rank tnfrsf11a - by Bioz Stars, 2026-09
    94/100 stars
      Buy from Supplier

    94
    OriGene myc ddk
    Myc Ddk, supplied by OriGene, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/ddk+myc+tags/L2HGDH+(NM_024884)+Human+Tagged+ORF+Clone/pmc13134639-208-25-31
    Average 94 stars, based on 1 article reviews
    myc ddk - by Bioz Stars, 2026-09
    94/100 stars
      Buy from Supplier

    94
    OriGene pcmv6 mettl7a myc ddk pmettl7a
    Pcmv6 Mettl7a Myc Ddk Pmettl7a, supplied by OriGene, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/ddk+myc+tags/METTL7A+(NM_014033)+Human+Tagged+ORF+Clone/pm42009961-62-14-20
    Average 94 stars, based on 1 article reviews
    pcmv6 mettl7a myc ddk pmettl7a - by Bioz Stars, 2026-09
    94/100 stars
      Buy from Supplier

    94
    OriGene mouse foxo1 nm 019739 myc ddk aav plasmid
    ROCK2-mediated thermogenic gene expression may occur through the <t>JNK/FOXO1/UCP1</t> axis (A) Western blotting and quantification of FOXO1 in sWAT from male WT mice housed at room or cold temperature for 3 h ( n = 4 mice per group). (B) Ucp1 expression in sWAT from male WT mice housed at 4 °C for 0, 3, 6, or 12 h ( n = 4 mice). (C) Ucp1 expression in sWAT harvested from control mice and then treated with 40 μM isoproterenol (Iso) and/or 4 μM FOXO1 inhibitor (AS1842856) for 6 h ( n = 4 wells per group). (D) Foxo1 expression in sWAT from male control and AdR2KO mice housed at RT or cold for 3 h ( n = 4 mice). (E) Western blotting and quantification of nuclear FOXO1 (nFOXO1), cytoplasmic FOXO1 (cFOXO1), and total FOXO1 (tFOXO1) in sWAT from male control and AdR2KO mice housed at RT or cold for 3 h ( n = 3 mice). (F) Western blotting and quantification of phosphorylated JNK (pJNK) and total JNK (tJNK) in sWAT from male WT mice housed at RT or cold for 3 h ( n = 3 mice). (G) Foxo1 expression in sWAT harvested from control mice and then treated with 40 μM isoproterenol (Iso) and/or 100 μM JNK inhibitor (SP600125) for 6 h ( n = 6 wells per group). (H) Western blotting and quantification of pJNK and tJNK in sWAT from control and AdR2KO mice housed at RT or cold for 3 h ( n = 3 mice). (I) Foxo1 and (J) Ucp1 expression in differentiated primary adipocytes from sWAT of control and AdR2KO mice. After differentiation for 8 days, mature adipocytes were treated with or without 10 μM isoproterenol (Iso), 1 μM AS1842856, or 50 μM SP600125 for 6 h n = 5–6 wells in (I); n = 3–8 wells in (J). (K) The mRNA levels of Mapk8 (encodes JNK1), Foxo1 , Ppargc1a , and Ucp1 in mature mouse adipocyte cells, 3T3-L1. Adipocytes were transfected with siRNAs for 72 h and then treated with 10 μM isoproterenol (Iso) for 6 h ( n = 6 wells per group). (L) The mRNA levels of Foxo1 , Ppargc1a , and Ucp1 in differentiated mouse primary adipocytes from sWAT of control and AdR2KO mice. Adipocytes were transduced with low ( Foxo1L ) and high ( Foxo1H ) MOI of AAV-8 containing mouse Foxo1 plasmid for 7 days and then treated with 20 μM isoproterenol (Iso) for 16 h ( n = 8 wells per group). The immunoblot images are representative of at least three independent experiments. p values were determined by the two-tailed Student’s t test (A and F) or one-way ANOVA with Tukey’s multiple comparisons test (B-E and G-L). All data are presented as the mean ± SEM of at least three independent biological replicates. See also and . AS: AS1842856; SP: SP600125.
    Mouse Foxo1 Nm 019739 Myc Ddk Aav Plasmid, supplied by OriGene, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/ddk+myc+tags/Foxo1+(NM_019739)+Mouse+Tagged+ORF+Clone/pmc13014674-465-7-17
    Average 94 stars, based on 1 article reviews
    mouse foxo1 nm 019739 myc ddk aav plasmid - by Bioz Stars, 2026-09
    94/100 stars
      Buy from Supplier

    Image Search Results


    ROCK2-mediated thermogenic gene expression may occur through the JNK/FOXO1/UCP1 axis (A) Western blotting and quantification of FOXO1 in sWAT from male WT mice housed at room or cold temperature for 3 h ( n = 4 mice per group). (B) Ucp1 expression in sWAT from male WT mice housed at 4 °C for 0, 3, 6, or 12 h ( n = 4 mice). (C) Ucp1 expression in sWAT harvested from control mice and then treated with 40 μM isoproterenol (Iso) and/or 4 μM FOXO1 inhibitor (AS1842856) for 6 h ( n = 4 wells per group). (D) Foxo1 expression in sWAT from male control and AdR2KO mice housed at RT or cold for 3 h ( n = 4 mice). (E) Western blotting and quantification of nuclear FOXO1 (nFOXO1), cytoplasmic FOXO1 (cFOXO1), and total FOXO1 (tFOXO1) in sWAT from male control and AdR2KO mice housed at RT or cold for 3 h ( n = 3 mice). (F) Western blotting and quantification of phosphorylated JNK (pJNK) and total JNK (tJNK) in sWAT from male WT mice housed at RT or cold for 3 h ( n = 3 mice). (G) Foxo1 expression in sWAT harvested from control mice and then treated with 40 μM isoproterenol (Iso) and/or 100 μM JNK inhibitor (SP600125) for 6 h ( n = 6 wells per group). (H) Western blotting and quantification of pJNK and tJNK in sWAT from control and AdR2KO mice housed at RT or cold for 3 h ( n = 3 mice). (I) Foxo1 and (J) Ucp1 expression in differentiated primary adipocytes from sWAT of control and AdR2KO mice. After differentiation for 8 days, mature adipocytes were treated with or without 10 μM isoproterenol (Iso), 1 μM AS1842856, or 50 μM SP600125 for 6 h n = 5–6 wells in (I); n = 3–8 wells in (J). (K) The mRNA levels of Mapk8 (encodes JNK1), Foxo1 , Ppargc1a , and Ucp1 in mature mouse adipocyte cells, 3T3-L1. Adipocytes were transfected with siRNAs for 72 h and then treated with 10 μM isoproterenol (Iso) for 6 h ( n = 6 wells per group). (L) The mRNA levels of Foxo1 , Ppargc1a , and Ucp1 in differentiated mouse primary adipocytes from sWAT of control and AdR2KO mice. Adipocytes were transduced with low ( Foxo1L ) and high ( Foxo1H ) MOI of AAV-8 containing mouse Foxo1 plasmid for 7 days and then treated with 20 μM isoproterenol (Iso) for 16 h ( n = 8 wells per group). The immunoblot images are representative of at least three independent experiments. p values were determined by the two-tailed Student’s t test (A and F) or one-way ANOVA with Tukey’s multiple comparisons test (B-E and G-L). All data are presented as the mean ± SEM of at least three independent biological replicates. See also and . AS: AS1842856; SP: SP600125.

    Journal: iScience

    Article Title: Induction of adipocyte thermogenic program by Rho-associated coiled-coil containing kinase 2

    doi: 10.1016/j.isci.2026.115225

    Figure Lengend Snippet: ROCK2-mediated thermogenic gene expression may occur through the JNK/FOXO1/UCP1 axis (A) Western blotting and quantification of FOXO1 in sWAT from male WT mice housed at room or cold temperature for 3 h ( n = 4 mice per group). (B) Ucp1 expression in sWAT from male WT mice housed at 4 °C for 0, 3, 6, or 12 h ( n = 4 mice). (C) Ucp1 expression in sWAT harvested from control mice and then treated with 40 μM isoproterenol (Iso) and/or 4 μM FOXO1 inhibitor (AS1842856) for 6 h ( n = 4 wells per group). (D) Foxo1 expression in sWAT from male control and AdR2KO mice housed at RT or cold for 3 h ( n = 4 mice). (E) Western blotting and quantification of nuclear FOXO1 (nFOXO1), cytoplasmic FOXO1 (cFOXO1), and total FOXO1 (tFOXO1) in sWAT from male control and AdR2KO mice housed at RT or cold for 3 h ( n = 3 mice). (F) Western blotting and quantification of phosphorylated JNK (pJNK) and total JNK (tJNK) in sWAT from male WT mice housed at RT or cold for 3 h ( n = 3 mice). (G) Foxo1 expression in sWAT harvested from control mice and then treated with 40 μM isoproterenol (Iso) and/or 100 μM JNK inhibitor (SP600125) for 6 h ( n = 6 wells per group). (H) Western blotting and quantification of pJNK and tJNK in sWAT from control and AdR2KO mice housed at RT or cold for 3 h ( n = 3 mice). (I) Foxo1 and (J) Ucp1 expression in differentiated primary adipocytes from sWAT of control and AdR2KO mice. After differentiation for 8 days, mature adipocytes were treated with or without 10 μM isoproterenol (Iso), 1 μM AS1842856, or 50 μM SP600125 for 6 h n = 5–6 wells in (I); n = 3–8 wells in (J). (K) The mRNA levels of Mapk8 (encodes JNK1), Foxo1 , Ppargc1a , and Ucp1 in mature mouse adipocyte cells, 3T3-L1. Adipocytes were transfected with siRNAs for 72 h and then treated with 10 μM isoproterenol (Iso) for 6 h ( n = 6 wells per group). (L) The mRNA levels of Foxo1 , Ppargc1a , and Ucp1 in differentiated mouse primary adipocytes from sWAT of control and AdR2KO mice. Adipocytes were transduced with low ( Foxo1L ) and high ( Foxo1H ) MOI of AAV-8 containing mouse Foxo1 plasmid for 7 days and then treated with 20 μM isoproterenol (Iso) for 16 h ( n = 8 wells per group). The immunoblot images are representative of at least three independent experiments. p values were determined by the two-tailed Student’s t test (A and F) or one-way ANOVA with Tukey’s multiple comparisons test (B-E and G-L). All data are presented as the mean ± SEM of at least three independent biological replicates. See also and . AS: AS1842856; SP: SP600125.

    Article Snippet: The custom-made AAV serotype 8 (AAV-8) containing mouse Foxo1 ( NM_019739 )-Myc-DDK AAV plasmid was purchased from OriGene.

    Techniques: Gene Expression, Western Blot, Expressing, Control, Transfection, Transduction, Plasmid Preparation, Two Tailed Test

    ROCK2 deletion decreased the oxygen consumption rate in AdR2KO mice after cold exposure The whole-body oxygen consumption rate (VO 2 ), carbon dioxide production rate (VCO 2 ), and respiratory exchange rate (RER) in 10- to 12-week-old male control and AdR2KO mice housed at (A) room temperature (RT) or (B) cold (4 °C) for 72 h ( n = 6 mice per group). (C) The mRNA expression of brown fat-selective genes ( Ppargc1a , Ucp1 , and Cidea ) and general adipocyte genes ( Adipoq and Slc2a4 ) in the sWAT of male control and adipocyte-specific constitutively active ROCK (AdcaRK) mice ( n = 6 mice per group). (D) Immunohistochemistry for UCP1 in sections of sWAT from control and AdcaRK mice housed at RT or 4 °C for 3 days ( n = 3 mice per group). High-magnification images are shown in the boxed squares. The scale bars are 5 mm and 100 μm in the low- and high-magnification images, respectively. The images are representative of three independent experiments. (E) The mRNA level of Ucp1 in sWAT harvested from control and AdcaRK mice and then treated with 40 μM isoproterenol (Iso) and 4 μM FOXO1 inhibitor (AS1842856) for 6 h ( n = 6 wells per group). (F) The mRNA levels of Foxo1 and Irf4 in sWAT from male control and AdcaRK mice housed at RT or cold for 3 days ( n = 6 mice per group). p values were determined by two-tailed Mann-Whitney U tests (A and B) or one-way ANOVA with Tukey’s multiple comparisons test (C, E, and F). All data are presented as the mean ± SEM of at least three independent biological replicates. See also . AS: AS1842856.

    Journal: iScience

    Article Title: Induction of adipocyte thermogenic program by Rho-associated coiled-coil containing kinase 2

    doi: 10.1016/j.isci.2026.115225

    Figure Lengend Snippet: ROCK2 deletion decreased the oxygen consumption rate in AdR2KO mice after cold exposure The whole-body oxygen consumption rate (VO 2 ), carbon dioxide production rate (VCO 2 ), and respiratory exchange rate (RER) in 10- to 12-week-old male control and AdR2KO mice housed at (A) room temperature (RT) or (B) cold (4 °C) for 72 h ( n = 6 mice per group). (C) The mRNA expression of brown fat-selective genes ( Ppargc1a , Ucp1 , and Cidea ) and general adipocyte genes ( Adipoq and Slc2a4 ) in the sWAT of male control and adipocyte-specific constitutively active ROCK (AdcaRK) mice ( n = 6 mice per group). (D) Immunohistochemistry for UCP1 in sections of sWAT from control and AdcaRK mice housed at RT or 4 °C for 3 days ( n = 3 mice per group). High-magnification images are shown in the boxed squares. The scale bars are 5 mm and 100 μm in the low- and high-magnification images, respectively. The images are representative of three independent experiments. (E) The mRNA level of Ucp1 in sWAT harvested from control and AdcaRK mice and then treated with 40 μM isoproterenol (Iso) and 4 μM FOXO1 inhibitor (AS1842856) for 6 h ( n = 6 wells per group). (F) The mRNA levels of Foxo1 and Irf4 in sWAT from male control and AdcaRK mice housed at RT or cold for 3 days ( n = 6 mice per group). p values were determined by two-tailed Mann-Whitney U tests (A and B) or one-way ANOVA with Tukey’s multiple comparisons test (C, E, and F). All data are presented as the mean ± SEM of at least three independent biological replicates. See also . AS: AS1842856.

    Article Snippet: The custom-made AAV serotype 8 (AAV-8) containing mouse Foxo1 ( NM_019739 )-Myc-DDK AAV plasmid was purchased from OriGene.

    Techniques: Control, Expressing, Immunohistochemistry, Two Tailed Test, MANN-WHITNEY